Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
hsa_circ_0001756 | |||
Gene | Organism | Human | |
Genome Locus | chr7:139415731-139416814:- | Build | hg19 |
Disease | Ovarian Cancer | ICD-10 | Other and unspecified female genital organs (D07.3) |
DBLink | PMID | 31589961 | |
Experimental Method | |||
Sample Type | Tissue and cell lines | Comparison | Serum (4ml per person) from 3 epithelial ovarian cancer patients who had not received cancer therapy and 3 healthy control women |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward GTGCTGGCTGAGACCCTAAC ReverseAGCAGCATCTGGAACAAGGT | Statistics | Fold Change : Upregulated pvalue : <0.05 |
Citation | |||
Wang, J, Wu, A, Yang, B, Zhu, X, Teng, Y, Ai, Z (2020). Profiling and bioinformatics analyses reveal differential circular RNA expression in ovarian cancer. Gene, 724:144150. |